Clearance Bedding Sets & Accessories | Bed Bath & Beyond
Nursery Bedding Sets for Sale - eBay
Bedding Sale | Bedding Sets Sale | wilko.com
Embroidered, Trendy used bedding for sale for Cozy Sleep
Bedding Accessories: Gently Used Items at Cheap Prices
Vintage & Used Bedding for Sale | Chairish
Bedding for sale | In Stock | eBay
Bedding, Comforters & Bed Sets | Big Lots
used bedding sets for sale
used bedding sets for sale - win
I picked up this Heywood Wakefield Kohinoor bed set with a twin bed from a small town antique/estate sale shop for pretty cheap when I moved a couple years ago. I have used it since then and intend to refinish it when I can. Does it count as MCM? The original dealer sticker says 1949 I believe.
How to Save Money as a Reptile Keeper (In my 10 years of experience.)
Hello! Long time lurker here and owner of 8 snakes and 2 leopard geckos. Assuming most of us here keep reptiles, we’ve probably all experienced the hefty prices associated with keeping them. That’s not to say that they’re not worth it of course but they can definitely be a hassle. However there’s a few ways and methods you can use to save you a lot of money while still keeping healthy animals. Here I’m gonna share some tips that I’ve learned in my 10+ years of keeping that have saved me serious money. If you have any other ideas or methods that I have not named to save money, please comment them down below because it could really help out other keepers. Disclaimer, this post is NOT meant to cut corners on animal care. There’s a huge difference between saving money in a few places and neglecting your animals. Animal abuse or neglect will not be tolerated.
Buying in bulk.
Snake food can be pretty expensive. ESPECIALLY if you choose to buy individually or in small quantities. However I’ve found that buying in bulk (usually online) is a great way to save money. I was paying roughly 60$ monthly in mice for my snakes when I bought them in store, but when I switched to bulk online I started paying around 200$ for about 9 months worth of food. Frozen bulk mice are usually vacuum sealed, and can usually last up to a year if stored properly. Personally I recommend RodentPro, though they don’t vacuum seal, the mice are always excellent quality, long lasting, and my snakes love them. Perfect Prey is another great option and you can find many more online.
Breeding your own feeders.
I’m mostly talking bugs here, but if you have the resources to breed mice then this applies to you as well. Breeding feeders will also save you a lot of money. Sure it might cost a little to maintain and set up initially, but if you have many lizards this might be the right option for you. There’s plenty of care guides online on how to breed, roaches worms and crickets and having them breed on their own can save you a lot especially in the long run as well.
Craigslist.
Tanks are expensive no doubt. They’re arguably the most expensive initial payment you’ll have to make outside of the actual reptile. Lucky for us keepers though, you can definitely find some wonderful deals on Craigslist. I’ve seen untouched 24 in. Exo Terras on sale for under 100$. Often times I see very large fish tanks being sold for low prices as well. You can even find other supplies like lights or heat sources and even animals as well. However this comes with its risks, and before buying anything on Craigslist make sure you’re setting up a safe environment for yourself, the seller and maybe even an animal needing to be rehomed.
The fish section.
Anything labeled “reptile” is gonna be more expensive, so why not head to the fish section instead? This applies to chain pet stores and local pet stores. Petco every once in a while has a dollar per gallon sale meaning 10 gallon tanks are 10$ and 20 gallons are 20$ etc. Petsmart doesn’t have this sale unfortunately but still has fish tanks for pretty cheap, in comparison to the expensive ones labeled “reptile”. Most chain pet stores also offer coupons which can help you save even more. If you don’t support these companies even for supplies that’s totally ok, and you’re not exempt from saving money based on this. Local pet stores often have cheap fish tanks on sale as well. You’ll probably need to get a lid, but in my experience a fish tank and lid are at least half the price of a reptile tank of equivalent size.
Dumpster diving.
Wanna feel like a criminal? This option might be for you. Granted, this is illegal in some areas so you must check your local laws before doing so but it can really pay off. Chain pet stores often dump tanks with minor scuffs or cracks, as well as other supplies with minor damage. I’ve seen people find large tanks with tiny cracks, working Reptifoggers, and many other decorations. As I mentioned before dont dumpster dive without checking the laws in your area first. If you’re up for digging around in dog poop and other waste for a good deal and it’s legal in your area, who knows you might find some lost treasure.
Generic equivalents.
I already mentioned before how reptile related products are more expensive and the same applies here. There are plenty of other things you can buy online that are pretty similar to what you could find for your reptile in a pet store for a highly discounted price. For any sort of heat lamps you can usually find a generic lamp online for a few bucks in comparison to the 10-30$ ones directed at reptiles. Fish tank LED lights are wonderful if you have a bio active enclosure, or just want to give your pet a day and night cycle. They usually cost around 20-40$ on Amazon, great for plant growth and last forever, in comparison to reptile specific ones which might fetch double the price and not last as long. If you’re lazy like me and hate manually unplugging lights you can also find light timers online for a few dollars as well instead of buying the Zoo Med ones. That being said though there are a few things I would NOT recommend and you should buy through Zoo Med, Exo Terra and other reptile brands. This includes things like supplements, heat pads and UVB bulbs.
Finding sticks and rocks outside.
Sticks and rocks are so expensive to buy it’s ridiculous. For a cheap alternative you can find rocks sticks and even bedding for your animals outside. Personally I don’t like using dirt from outside but some people do. However the dirt can be used for naturalistic backgrounds as well which is pretty handy. But before you throw your sticks into your animals enclosure they must be sanitized. There’s plenty of tutorials online for cleaning wood, rocks and dirt to sanitize for your animal and anything from outside MUST be cleaned properly. Keep in mind that pine and cedar are also toxic for most reptiles as well as other types of wood so make sure you know what type of wood you’re collecting.
Michael’s (or other similar craft stores.)
Yeah yeah, Exo Terra and Zoo Med plants are fine and all, but they’re so unrealistic in my opinion and they’re very expensive for what little ground they cover. Michaels can fix that problem too. Michaels usually has a lot of fake tropical plants and succulents and for a fair price. They usually have very large (12 inch or bigger) plants for around 20$ with wide leaves making them great for arboreal species as well. They usually have deals as well and you can find many coupons online. Overall I just enjoy the look of their plants much more and they can make a boring tank really come alive while saving you money.
Aliexpress.
Yes. Aliexpress is sketchy. But you can definitely find some nice stuff on there, mainly plants that are super super cheap and often very realistic as well. Usually you can find a large Michaels size bush for a couple dollars plus shipping. With 40$ I was able to buy enough plants to fill like 3 20 gallon enclosures. I highly recommend this, it’s completely safe for your reptiles and can save you a ton of money. I’ve also seen people get lucky on Wish too. I also wouldn’t recommend buying any electrical products like heat pads on there, since they’re just such a vital piece and need to function properly, although I’ve had people say they’re fine. Just make sure to check the reviews first.
Go bioactive.
Bioactive tanks are becoming more popular in the reptile community and for good reason. They’re definitely expensive to set up but not to maintain. With bioactive enclosures you can get springtails or isopods which actually eat your animals droppings and create fertile soil. Usually with bioactive substrate you do not need to change it although spot cleaning is still a good idea. This will definitely save you on bedding, and it just looks so much cooler. And if you’re terrible with plants like me, fake plants can work as well. I highly recommend switching to bioactive if you can afford it, it just looks so much better and your animals will love it. Since switching to bioactive, I’ve not had to change the bedding often if at all and it’s saved me a ton.
Paper towels and containers.
Ok this only works for some species but it can work. Personally I don’t use this unless I have an animal in a temporary enclosure, or that is ill. I think it just looks bad, but it can be ok for some animals and definitely temporarily. Perk wise though, it’s cheap it’s easy to clean and can maintain humidity. This probably won’t work for a lot of burrowing species though, and like I mentioned before it just looks bad in my opinion. Containers are similar in that sense except they can probably be used forever. Instead of buying fancy water dishes you could just use a container or cut it up and make a hide. Both are totally ok and have helped people save a lot of money in the long run especially those with many animals.
Garage racks.
If you have a lot of animals chances are you’ve already done this. They’re fantastic. They’re heavy duty, long lasting and honestly don’t look that bad. They’re also super cheap. A 4 tier rack for 20-40 gallon tanks could cost as little as 50$. They’re also super easy to set up. I set up my first one when I was 12. Same could also be said for rack systems for breeders. Personally I’m not the biggest fan of rack systems, but many people are, and If you plan on breeding they’re almost a must, at least a small one. They can be pretty expensive but for the amount of space it gives you, it’s a solid investment.
Buy cork in bulk.
I use it for everything, it’s the best wood out there. But it can be pricey. So like I mentioned with feeders, just buy in bulk. Don’t buy a 8 inch piece for 10$ just spend 50$ for a nice box full.
Don’t use expensive bioactive bedding on the background.
This is something I see fairly often. A new keeper buys a ton of The Biodude Terra Firma and uses half of it on the background. Considering how expensive this stuff is just don’t do that. Please. You can buy Eco Earth in a 3 pack set of 8qt bricks for 5$ on LLLReptile. That’s 24qts for 5$ just use that instead.
LLLReptile.
I don’t really know if I’d recommend them for actual animals, but for supplies it’s the best deal you can get. Sure their shipping is 4-7$ but they have some of the best customer service, at least in my opinion. They have pretty much every reptile product you can think of for a fraction of the price of Amazon. They have the best deals and I’ve saved a lot of money on supplies thanks to them. For now I think those are all I can think of. If I missed any please let me know in the comments, I hope that this post can be a safe place for reptile keepers who are trying to save cash here and there. As I mentioned before keep in mind that there’s a difference between saving money and neglect. There’s also a difference between thriving and surviving. Just because something can LIVE with something doesn’t mean it’s happy (for example a ball python on paper towel in a rack system with nothing but a water bowl.) I want to make it especially clear that any neglect labeled under “tips to save money” is absolutely not tolerated here. All animals need a minimum care standard, and anything that doesn’t meet with that criteria is not ok to comment. Anyways thank you for listening to my enormous list and I hope that by posting this I can at least help one person save some money. :)
NaCl NaCl NaCl NaCl, hey hey hey, goodbye... a Sparkies Tale
This is a bit of a read, hey. The title will make sense at some stage, I promise. I'll explain some stuff as we go, but as always, there's a Glossary at the end. Some years ago I was working FiFo (Fly In, Fly Out) at a mine. Leave the small-ish town I was living in at the time, fly to the mine for two weeks, fly back home for one week. Rinse, repeat. As a dual trade sparky/instro, it was big hours and looooots of Beer Tickets. (sparky/instro - electrician/instrumentation electrician) With all the fat stacks of bills I was being paid, I decided to buy a fixer-upper house that I could work on during my weeks off, with a view to selling at some stage. My construction industry mates would help, on occasion, for beer and BBQ. This is The Way. —- The house was an old wooden single story, 4 bed, 1 1/2 bath affair, on a half acre (2000sqm/21780 sqf), WITH A BIG SHED! Seriously, the shed was a big 4 bay job with power and water. And a John Deere ride-on mower for all the green shit. It had come up at an estate sale, the previous owners having been there for over 25yrs. It needed the usual paint and mending, a fair bit of modernisation, a bit of renovation, but was overall a solid house in an established neighbourhood. All the blocks around there were half acre. The first day I was moving in, I hadn't been there for an hour, and had one of the neighbours visiting. (There are two types of neighbours who come over within an hour. The "Here is a casserole, welcome to the neighbourhood" type, and the "Bill and Jenny" type.) Bill and Jenny - Antagonists "Bill" was a retired Barrister, "Jenny" a retired Surgeon. (A Barrister is a highly skilled Specialist Solicitor who wears a wig. A Solicitor is a regular Lawyer who doesn't wear a wig.)(I had to ask a Barrister some questions regarding an upcoming court case once. Thought I'd just ring them up. 30mins on the phone cost me $500. Wigs are no joke.) Anyway, Bill and Jenny came over with the "Hello peasant, this is a quiet neighbourhood" yada yada bullshit. They'd been at their house for over 20yrs. I was courteous and respectful, explained that I would be in and out due to being a FiFo Contractor, didn't party, and the only noise would be fixing up the house. Well. Bill and Jenny were most assuredly not impressed. I don't know if it was the Contractor bit, or the fixing up the house bit, but I don't think their faces could've looked any more souhorrified if I'd leant in and given them a big lick up the face. I received a legal brief on the Noise Laws, and repeated assertions that this was a "Quiet Neighbourhood". Bill was also kind enough to let me know that "Everyone around here has pride in their gardens/lawns and it would be a shame if I were any different". Jesus fuck Bill, OK, I get it. Bill has no chill. I let him wander off with his Alpha attitude and went about moving in. Dave and Bec "Dave" and "Bec" (from over the other fence) came over just on sunset with their teenaged kids, beers and pizza. Dave was a High School Principal and Bec was a Nurse. They asked how it went with Bill and Jenny and we had a good laugh. Dave told me how Bill comes over and gives unsolicited gardening advice. Dave, Bec and their kids were tops. All through the first day I'd seen Bill pottering around in his garden. Garden isn't the right word though. Apart from the house, their half acre was like the local Botanical Gardens. Gazebo, Pool, Pond and all. Dave told me how Bill bragged about his rare trees and flowers and shit. (Can you tell I love gardening? Honestly, grass is just something you pull up to pave or concrete over.) After the first week, I'd moved in and had begun the plans for the work I wanted to do. With the title to the house had come a copy of the previous owners application to build a deck off the rear and side of the house. Nice BIG DECK. I stepped out the plans, decided that this BIG BEAUTIFUL DECK would do nicely, and had My PeopleTM begin looking into whether the plans were still valid/needed updating. I'd also serviced the mower (in my BIG SHED) and done the lawn, to the not-so-surreptitious scrutiny of Bill. Then it was off to the mine for two weeks. Each week off I'd catch up on sleep and work a bit. This went on for a few months until I got my first proper Quarterly Utility Bill (Powewateetc). Now I could continue a habit I'd started years earlier. Just like everyone else does, when I'd moved in I recorded the power and water meter readings in my Utilities Diary. It's a good tool to monitor powewater usage. Comes in handy if you suspect a leak or power issues. (everyone has one, right?) Now that I'd had a bill I could Keep Records. The Issue Unfolds Month five I decided to replace the electrical switchboards in the house and BIG SHED (fuse box/breaker panel/load centedistribution board/I don't know where you live and what you call it there). To do this, I killed the power at the front Main Switch at the Meter Box. This means my whole block would have no power. While changing out the switchboards, I'd also do a full test of the electrical cabling, outlets, etc. This testing was done, by law, prior to sale, but not by me. So of course I had to check it. Two things were weird during this time. 1) The cable over to the shed tested "not as expected". 2) Bill was watering some of his flower beds by hand. (There are now some readers who have guessed what the underlying "Corpus Delecti" is in this tale.)(Some have probably figured out what the title means) Bills whole garden, like mine, had an automatic irrigation system. At set times and days, the whole grounds would get watered by a pump and timers. This usually happened three times a week around sunset. His flower beds had misters, potted plants had drippers, and the lawn had the pop-up rotating "chuk, chuk, chuk, chuk, brrrrrr" sprinklers. (I wrote this out so you'd make the noise in your head. You're welcome.) I'd never seen Bill water by hand with a hose. Weird. The Shed circuit intimated that it either had a fault in the underground cable, or it had some electrical equipment connected, even though I'd unplugged everything for testing. So, the undergrounds then. I'd have to try and find the undergrounds and investigate. this would mean pulling them out and possibly replacing them, but that could wait for tomorrow. I'd just do the house switchboard that day. Next day, I borrowed a cable locator from a mate and traced the shed undergrounds, marking with my favourite pink paint. The Shed undergrounds were about 1m/3ft inside my fence line, and were fed from the power meter box at the front of the property. About half way between the house and Shed I ran into more weird. It appeared that there was a branch off the underground shed power cable. Heading into Bills property. Looking over the fence, the first thing I could see in line with this branch was Bills little hut that housed his pool pump/filteirrigation controls/irrigation manifolds/valves. This hut was about 3m/10ft inside his fenceline. Because this cable locator also located water pipes, I found that the shed water pipe also branched at this point. Things were less weird now. After marking the whole underground services trench, I packed up the gear and went about changing out the house switchboard. And had a nice think. The Plan was formed. The next day I got My PeopleTM to look into public records of when Bills pool, and my Shed had been built. I also went and bought some cameras and a recorder. The last couple of days of the week I did a few things.
Using surveyors pegs hammered into the ground, I marked out where the BIG BEAUTIFUL DECK would be going. I didn't want anyone suspicious about why I'd marked the Shed underground services trench.
I put up the cameras. One facing down the side of the house that would capture the water and power meter at the front of the property. One facing my Shed, which would inadvertently capture Bills Pool Hut. Perfectly legal.
I installed a mini power meter just for the shed circuit, so I could monitor power usage to the shed.
I changed my irrigation timers to match Bills. Just in case.
The last thing I did before heading back to the mine was to turn the shed power circuit off, and the main water valve off. Of course, the meter readings went in my Utilities Diary. My grounds might not be watered for two weeks, but sometimes you gotta break some eggs. And everyting was that smug-green shade anyway. It could do with being taken down a peg. When I got home the next week off, I casually went over to the meters, and wouldn't you know it! The brand new power meter for the shed had NUMBERS on it. Mainly because it was now turned on. The water meter had a higher reading and the water valve was turned on. So, big bold Bill, huh. Just leaving this stuff on for me to find. Next I checked the cameras.
See Bill at his pool hut the day after I've left, looking at the irrigation system with puzzlement.
See Bill walking off frame, to appear on the other camera looking at the meters. See Bill turning the water and power on.
See Bill going back to his place, checking the irrigation system. See the sprinklers come on.
I'd also had a call while at the mine from My PeopleTM telling me that Bills pool, and my shed, had gone in around the same time 10yrs ago. Bill, Bill, Bill. You silly wig wearing wanker. Phase 2 of the plan included making the hole deeper for Bill. One day when he was out in the garden, I called over to him and asked if he'd seen anyone messing around with the powewater meters. (The meters were at the front of the property, like they did back in the day, to make it easier for the meter readers from the Utility companies. This meant that kinda anyone could come and mess with them.) Bill came over and said no. I made sure to stand in a particular spot at the fence, so this exchange was captured by the camera. When I left for the mine, I not only recorded the meter numbers and turned the powewater off, I put an "Out of Service" tag on the Shed circuit, and another on the water valve. These were dated and I took photos. So now we can establish just how bold Bill was, because when I got home the tags were gone, and the powewater was on again. I again went through the asking-over-the-fence shtick. Again Bill denied any Scienter. Two chances to own up. Okie dokie, Phase 3. Just so everyone is caught up: Bill had been at his property for 20yrs+. The Pool and shed went in 10yrs ago. The Pool Hut, with the pump and filter, and irrigation system went in at the same time. You could see that the hut had been designed to house all of it. Bill might have been knowingly stealing power and water for 10yrs. He certainly had no problem stealing power and water off me. Fuck Bill and all his green shit. I visited a couple of Mates to pick up some items and went to work. - In the Shed, I got the borrowed 200L/53gal drum, filled it with water and emptied a 20kg/44lbs bag of goodness into it. It took a while to stir it all in and dissolve. - I set up the dosing pump for the drum, and ran a lead over to my irrigation system to power it and turn it on. - At 2am, with my headlamp on, feeling all Jason Bourne, I went and turned my water off. After running the taps in the house to remove the pressure, I put some plastic down near the powewater branch (for the dirt), and very carefully dug a hole.
Exposing the water line going over to Bills place, I fixed a tapping saddle to the water pipe. (Remember, this pipe over to Bills place was coming off MY water pipe.) Onto the tapping saddle I fitted the end of a length of small clear plastic tubing and filled in the hole. The grass fit back into place just nicely.
The plastic tubing I ran along the fence to the Shed, tucked into the grass, and attached the other end to the dosing pump. The delivery system was ready.
After turning my water back on, I turned my taps on to re-pressurise the lines.
Then I cleaned up went to bed.
Later that day, around midday, I went next door and knocked. One last chance Bill. Jenny answered the door, and I asked if I could have a word with them both about their pool and irrigation watepower. Jenny knew. She paused for a heart-beat and said they didn't have anything to talk about. As she was closing the door, I said that if Bill wanted to come and see me, I'd be home. Now, you might be thinking "Ok, this looks like it's going to be a bit of an extreme response." Here's what I'd put up with since I moved in: - Bill or Jenny asking me to keep the noise of the power tools down when I was working during the day. I only ever started after 9am and finished before 5pm. Our houses were about 100m/330ft apart. I was disturbing their "Gazebo time" during the day. - Bill and or Jenny calling the Police to my place for noise complaints when I had mates over helping. The worksite radio was low, and we were just being jocular, not rowdy. Dave and Bec had no issue and came over for the BBQs. - Bill had one of my fucking trees cut down while I was at work, because "it was too close to his fence." Yeah, ok, Frangipani flowers do get kinda everywhere, but still, it'd been there for years and he could have asked. - Bill tried to legally bully the Local Council into denying my BIG BEAUTIFUL DECK plans. The Deck plans had again been approved by the Local Council. Let me say this again: Bill tried to fuck with my deck. So, at about 5pm, Bills irrigation turned on. And so did my dosing pump. Have you ever heard the term "Salting the Earth"? The bag I'd emptied into the 200L/53gal drum was pool salt. NaCl. When Bills irrigation turn off, the drum was empty. It had pumped all the salt water into Bills irrigation system. 2am, I Jason Bourned the tubing out of the hole, sealed the tapping saddle, and packed up. The next morning I took my mates drum and pump back. At about 8am, I started digging up the services trench, all the way from the meter box to the shed. With breaks it took the whole day. When I got to the branch that led into Bill and Jennys place, I called them over to look at it. They denied any knowledge. I told them - that's ok, I was going to replace the cable and conduit to the shed anyway, so I'd just cut the stuff going to their place. I ended up jumping the fence and digging so I could rip the pipe and cable out of the ground on their side. A plumber mate came and helped fix my water pipe. Fallout Bills Garden - When I was digging my trench the next morning, I could see it all, everything, wilting. If he'd gotten a heap of water on it right away the night before.. who knows. Some of his rare trees may have survived. But by 8am the salt had been doing it's job for 13hours. When he saw what was happening, and figured out the cause, he connected his hose to the irrigation system and started watering. Everything turned yellow/brown. It took him months to get the plants that lived, back to being healthy. He told the local Horticultural Society (of which he was the president) that the pool water had somehow gotten into the irrigation. Bill and Jenny - The morning after, once he'd figured out what happened, they confronted me. I denied any knowledge and when he started threatening legal action, I told him about the tags, and video, and Utilities Diary, and pool/shed building documents. It drove him nuts not being able to do anything. He knew I did it. Thankfully, I had no more hassle from them. Me - I sold the house 1yr after starting, as planned, to avoid higher taxes on the sale. I bought another house and started again. My PeopleTM - Conveyancer. Like a human conveyor belt. They move paper from one place to another. BIG BEAUTIFUL DECK - Best. Deck. Ever. It went along the whole back of the house, and halfway round one side. It was 5m/16ft wide, roofed, and had a BBQ station and sinks built in. I still miss that deck. My Grounds - I managed to not kill any of my plants or stupid grass. Thank you for reading. Glossary Beer Tickets - Beer Tickets are Money. You hand over a red Beer Ticket ($20 note), you get 5 beers. A blue ticket ($10 note) gets you 2 beers. These conversion rates are from years ago. I don't know what the current conversion rates are. Corpus Delecti - Is either "Body of the Crime" or something to do with cooking. I'm pretty sure I've heard Gordon Ramsey say it before. But then, who could tell. Salting the Earth - Salt kills plants. I reckon, after seeing the results of one bag, had I put in three bags, (and I would have) there'd have been no recovery. Also, I'm pretty sure the soil would've needed quite a bit of remediation to ever grow anything again. It's kinda lucky for Bill that my mate only had one bag. I was in a bit of a mood that day. I had hoped for ground zero. Neighbours/Neighbourhood - I made sure to write this down as many times as I reasonably could. Just to annoy people with the "u". It's one of my favourite games. Grass - 15 spots of rain and you have to cut it again. Oh look, now it needs fertilizer. Now it needs shade..oops too much shade. Honestly, kids are easier. I remember the time I mowed the lawn as a 10yr old. Ran over some rocks. That was such a fun time. Mowing the lawn with bleeding legs and Dad saying, "That's just part of mowing the lawn mate." To be fair, I did only have shorts and thongs on. But still, Fuck grass.
I don't get what you guys are worried about with PLTR. Here's my personal DD on PLTR, you're welcome to read and do whatever you want. Other helpful info or pointing out mistakes in my DD is very welcome. Fears preventing you from buying PLTR
Targeted ads on your phone from Yahoo Finance or Zacks telling you PLTR = BAD!!!1!eleven
Shills spamming "pLtR tO tHe MoOn" and :rocket: on PLTR thread comments.
Last quarter's seemingly bad financials/earnings.
Financials Moving Forwards
Soros who owns 21 million shares "threatening" to sell his shares upon DPO expiry.
DPO expiry 3 days after February's earnings and possible insiders and DPO holders sale and dip.
What does PLTR tldr.
Other Information
#1 Targeted Ads Ads and articles are both paid for by someone.The fact that in the past 3 weeks i've been getting multiple multiple targeted ads on my phone related to PLTR since i love PLTR so much. Ads are telling me that PLTR is bad, doesn't provide a dividend, they're telling me PLTR's fair price is 20 instead of 25 based on some financial model and have gone as far as to provide a list of alternative stocks to buy. To me, this all screams: SCARE TACTICS Additionally, the last few weeks of ups and downs in PLTR's stock price is another indication of the attempts to short the stock to sh!t and drive investors out. (For what reason? I don't know.) #2 Shilling PLTR I myself love to shill PLTR to people whenever i can. I do this because i legitimately think this company will do great. I work as a product manager in a software development house and understand what PLTR does. PLTR is not cryptic.Regardless, i think when people shill PLTR to you, they are right to do so as you're probably missing out on a great opportunity to make money in the long run. If you're looking for big gains short term, maybe try something else. Shillery is OK, but at least give the facts. #3 Last Quarter's Bad Financials If you'd done your DD not by searching reddit posts but by checking PLTR's actual quarterly report, you'd know that PLTR's "bad" last financial quarteearnings were due to the costs of listing themselves on the New York Stock Exchange.~855million were spent on listing and stock related compensations and this is the big reason. Direct quote by PLTR here:https://investors.palantir.com/news-details/2020/Palantir-Reports-Revenue-Growth-of-52-in-the-Third-Quarter-Raises-Full-Year-2020-Guidance/default.aspx
We incurred a loss from operations of $847.8 million, which includes $847.0 million in stock-based compensation following our recent direct listing.
I would like to remind everyone that this is a 1 TIME THING. Put simply, this means that PLTR won't have as excessive losses next quarter as they did this last quarter. Additionally, let me go into further detail on this and not just leave it to that.
PLTR's quarterly operating expenses for the past 3 quarters were at around ~260 million.
PLTR's operating expenses this quarter were ~987 million.
On September 30, 2020, in connection with the Direct Listing, we incurred $769.5 million and $8.4 million of stock-based compensation using the accelerated attribution method related to the satisfaction of the performance-based vesting condition for RSUs and growth units, respectively, that had satisfied the service-based vesting condition as of such date.
#4 PLTR financials moving forwards PLTR is deep in bed with the government and the Biden regime although may look like it would be against using PLTR is in fact secretly very pro-surveillance e.g pro Palantir. Here's some of the known organizations in the US Govt that use PLTR:
CDC
Office of the Secretary
Food and Drug Administration
Immigration and Customs Enforcements / ICE
Internal Revenue Service / IRS
National Institute on Drug Abuse
DOD/ARMY - ACC Aberdeen Proving Ground
Coast Guard / DHS
DOD/NAVY - Naval Information Warfare Systems Command
US Attorney's Offices / DOJ
US Special Operations Command / SPEC OPS
Boys. The big institutional people know these things. You just found this out. See how deep PLTR is already in bed with the Government?????? Palantir IS the next Raytheon/Lockheed of DATA aggregation and visualization. UPCOMING EARNINGS I've done some quick maths and it looks like PLTR is more likely to be in positive earnings this quarter and with a 0.02 cent EPS target, we can easily assume that they'll destroy this with maybe 0.04 or 0.08 EPS. In the worst case scenario, PLTR's EPS this quarter could be somewhere around MINUS -0.05 ish due to interview costs and ad/campaigning costs that were not there before the company was listed. WHAT CAN DESTROY PALANTIR Now, there's big possible downsides and Palantir can fail IF contracts that expire are not renewed. That's biggest REAL reason for Palantir's balance sheet getting screwed. I've seen a disturbing pattern with PLTR's financials and that's that every year, it's R&D cost is rising by between 150 and 350 million dollars. This is quite a bit of negative revenue and if new contracts are not constantly coming in, PLTR's balance can start going into the negative. WHAT WILL NOT DESTROY PALANTIR Some people may have concerns over the new left leaning government dumping PLTR. An article was posted that is behind a paywall EVERYWHERE that goes something like this: https://www.thedailybeast.com/cdc-officials-urge-biden-team-to-dump-palantirs-covid-tracker In my opinion, i believe this is inconsequential and that a few people crying to daddy Biden to kill a multimillion contract with PLTR is a stretch. Also we know the current new Biden team has his hands full and will have them full for at least the next 1 year with what's going on. There is no time to deal with a few crybabies and even if he did deal with it and did decide to kill the PLTR Tiberius Covid tracker contract with the CDC which he WONT, these things take months and years to deal with, and by then the contract/s will have already brought PLTR tons of money and revenue in. HOW MUCH DOES KARP AND HIS GOONS GET PAID Short answer is... A LOT. The amounts below are PER YEAR. That's a lot of money in the hole and contributes to annoying amount to why PLTR is always just at the edge of just barely being profitable. https://preview.redd.it/ba58nqcurob61.png?width=2615&format=png&auto=webp&s=55d45833faad4d60ea8dc142a9601c44b4cc7395 Palantir's prospectus 311 page document's 130 last pages are almost all exclusively talking about extremely complicated options trading schemes that are made by Cohen and others to make sure they can squeeze out a LOT of money out of PLTR. Mithril Investments has existed from before and is not a new company. Owned by Thiel/Cohen/Karp as a way to launder and exchange options for more options and more money for all 3 of them. Also Shyam Sankar to me feels corrupt which scares me a bit, he's had some very shady dealings and has brought his wife in PLTR that gets paid 200k per year. Prospectus Document: https://www.sec.gov/Archives/edgadata/1321655/000119312520230013/d904406ds1.htm I suggest you skim through it, it contains EVERYTHING about Palantir. Palantir is going to need to have to be getting AT LEAST 500 million in NEW contracts per year to REMAIN BARELY profitable. It's doable in my opinion, but just barely and it's why they made the company public to try and get more people's attention and increase the inflow of contracts. #5 Soros and his 21 million shares First of all, i think we can all agree that Soros can suck it. If you've read a few articles here and there, you'll know that Soros owns/owned 1% of Class A PLTR shares. No one knows whether he's sold them yet or if he's an DPO holder who'll sell 3 days after February's earnings. Whether he sells them or buys more will be mostly inconsequential in my opinion. We see dips and pumps every day. He legally cannot sell his shares all at once, he'll have to sell certain amounts daily and over time. This will create annoying sideways motion as shares exchange hands and consolidation starts for 2-3 weeks until his and insider shares exchange hands. Nothing special to see here, move along just a little draw down resulting in some consolidation. PLTR is exposed to OIL more than anything, so fluctuations in the general market and general market crashes affect PLTR much less than other stocks. Also PLTR does not track ANY benchmarks. NONE. #6 DPO expiry 3 days after earnings in February To my limited knowledge, this is how BIG plays who are holding DPO shares usually work:
If a stock has performed well up to earnings and investors are more than happy with the returns, they're more likely to not sell their stock or just sell less than they normally would.
If a stock hasn't performed as well as investors thought, these investors are more likely to sell stock or reduce their positions more than normal.
There's a total of 1.16Billion Class A PLTR shares currently (Give or take don't flog me). We are currently trading with ~250 million shares while the rest are locked away in the DPO. When those shares are "unlocked" in February, the price of the stock won't be diluted. These shares already exist and are accounted for. They are simply locked. Also when they are unlocked, the share price won't simply multiply because all shares are now tradeable.
According to Palantir’s after-hours filing with the SEC this afternoon, the company has 1.16 billion Class A shares, 484 million Class B shares and 1 million Class F shares on its cap table outstanding today, or a total of roughly 1.64 billion. Only Class A shares will trade, and Class B and F shares are convertible to Class A shares on a one-to-one basis. On a fully diluted basis, which Palantir says represents 2.2 billion shares total according to its most recent S-1 filing, the company is valued at $16 billion. The difference between those two aggregate numbers comes from outstanding stock performance grants, warrants and other financial instruments.
What WILL affect stock price:
Employees exercising their non class A options into Class A shares. This IS dilution.
The bigwigs e.g Alex Karp, Peter Thiel and a few other bigshots exercising their options and then selling them for a profit.
To note, regular employees will barely affect the price of the stock with their miniscule share holdings. Alex Karp, Peter Thiel and a handful of other high ranked executives in PLTR are the ones that will create a tiny but manageable ripple in the stock price. What COULD affect the stock price a lot:
Massive sell off by the big institutional holders.
Not shorters. (Citron and Citi can suck it, we're in control here)
People with weak spaghetti wet paper hands.
Everyone fomoing the same weeklies e.g like when everyone bought Jan 15 calls on everything.
Big but silent scare campaign (that's already going on) to scare off normies like us.
#7 What does PLTR do, tldr. Imagine Facebook's database of everything about everyone & Youtube's Database of everything & Geolocation data in a database made by the US Army for known terrorist cells. Palantir allows you to select and match varied data TYPES from several different database, combine it in any way you want and visualize it so that it's human readable by even the dumbest person in the room so that even they can see patterns and come to conclusion on a subject matter. It's kind of like filling an excel sheet with data and then visualizing it with a bar chart, except the date you filled the sheet with can be anything and not just numbers or dates or countries and you can make various combinations using all the different rows of data to maybe come up with a pattern to something like how to best distribute the Covid vaccines in the counties in a very specific state in the US. Literally what you see in SciFi movies where people combine random data by smashing keys on a keyboard and somehow find the murderer, the location of a terrorist or the percentage that someone will commit a murder in the future based on a lot of random data about that person or the area, country, family, history... anything. While this all might sound super cool and amazing, it is. Maybe in 10 years time there will be a few more companies doing this, but for now, it's only Palantir, Circles, Alteryx and a few other private entities that do this type of thing. Many of them work with governments and are hush hush due to the kinds of things they use this type of software for (terrorist cells, warzones, etc) and the public backlash this could cause. tldr: Glorified data aggregator and visualization platform/software with different access levels for different people. PLTR is superbly positioned to offer their software to SLOW and Boomer like organizations like Governments. Governments are stupid and don't have neither the time, nor technical knowledge to develop this software themselves for internal use. This is what PLTR capitalizes on and why Governments use them so much. Governments could have spent the a fraction of the money they spend on PLTR contracts to make the software themselves but only for their own internal systems and use, but they can't and if they tried, they'd fail because technocracy in governments is not a thing. By the time they'd even complete a project like this, it'd likely be out of spec, unusable and would require further development and money and we know how slow and bad governments are at doing even the basics. Again PLTR wins because of this. PLTR is likely NOT to be adopted by giants like Google or FB or other modern tech organizations of any size because they are not stupid. They have their own purpose built internal systems that they use to do everything related to data aggregation and visualization because they have the technical knowledge and resources. Buying PLTR for their use is a joke. PLTR capitalizes on being general a general purpose tool and is set up manually by an engineer over the course of 4-10 days for each customer. The engineer customizes and configures the system for each company's custom use since the software allows you to do so. Regular aggregation and visualization software CAN do the same, but typically lacks data input types and features that PLTR has because PLTR has cultivated a special set of features over many years that were suggested by their existing clientele in battlefields and other places. #8 Other Information \*Big known PLTR Holders*\** https://preview.redd.it/a404oalxrob61.png?width=1631&format=png&auto=webp&s=8c2dbcfac5a7ca207127771ec4e3133f8d943359 \*PLTR's Price List (2019)*\** https://www.esi.mil/Download.aspx?id=7186 \*Personal TA and Crayon Mania*\** https://www.tradingview.com/chart/PLTnrjqL4dw-PLTR-Risky-April-100-200-possibility/ https://www.tradingview.com/chart/PLT5YcdCye0-PLTR-Schizzo-Technical-Analysis/ https://www.tradingview.com/chart/PLTCkCTvtqM-PLTR-PLTR-train-leaving-the-station-get-ready/ \*PLTR stock pumping events*\**
240 million Palantir Air Force contract expiring soon in 3 months. If it's re-signed, it'll be a big catalyst for a PLTR pump. If not, it'll be a sad dump day.
Mithril, investment/financial company owned by Karp and Thiel buys a 3.15million share stake in Palantir. Somehow this makes them major stakeholders.
The National Institutes of Health (NIH) intends to award a contract without providing for full and open competition to Palantir Technologies, Inc., 100 Hamilton Ave., Suite 300, Palo Alto, CA 94301.
Veteran Health Association - WON
The pandemic-related data management and operational decision-support requirements have led the program office to determine that the Palantir data management and analytics platform is the only viable solution that would maintain the current operational capability, without a degradation in VHA COVID-19 decision-support.
Subject Matter Experts (SMEs) held meetings in January/February 2020 timeframe with potential vendors to determine their capabilities and their abilities to meet this mission requirement. They met with Palantir, Recorded Future, Altyrex, In-Q-tel and Semantic AI. From the information they gathered in those meetings it was determined that Semantic AI would be the only company that could fully meet the requirements of this effort without further delaying the project and incurring additional costs
Now friends, here's my position on PLTR. I'll be holding onto it for the next year. If it's not at least 300% by then, i'm selling it and moving on to the next stock. App i'm using is Revolut. Also yes, i'm ALL-IN only on Palantir because i know my money will multiply itself in the short term. I'm not holding this till 2025 as others are supposedly doing. I'm selling in 2022 with 300% or more profit. PLTR is severely undervalued, underpriced because it's a DPO. Give it till EOY and we're going to be rich. If it was an IPO it'd be trading at 180+ already imho. I've spent the last month and a half holding PLTR. I've gone full schizzo mode when it comes to PLTR. I lose sleep daily and i love it. I hadn't slept for 37 hours a few days ago because i spent so much time researching PLTR and scraping the internet for all possible information. I come from an IT/Development background, so i understand what PLTR does completely. My PT's for PLTR are:
48-89 by March or April.
75 - 125 by EOY.
200+ 2022 IF they solve their income and constantly increasing R&D cost issues.
The Dardeen Family Murders: No Mercy, No Motive, No Answers.
It was November, 1987, in Ina, the southernmost village in Jefferson County, Illinois. Nestled among woodland stood a mobile home, on a piece of land rented from a nearby farm. The mobile home stood for sale, not only because the family living within were expecting their second child and could use some more space, but also because they did not like staying in the area, as it had been becoming increasingly violent. Jefferson County had seen 15 homicide cases in the past 2 years. Russel Keith Dardeen, 29, his wife Ruby Elaine Dardeen, 30, and their 2 year old son Peter had bought their trailer in 1986, after Russel had completed the training required for his job as a treatment plant operator. Keith got a job at a treatment plant, and Elaine at an office supply store in nearby Mount Vernon. In their free time the couple played in a musical ensemble in a local baptist church. They were looking forward to welcoming their second child, and had landed on either Ian or Casey for a name, depending on whether it was a boy or a girl. Shaken by the growing unrest in their area, Keith had become more protective of his family. When one night a young woman knocked on the door of his home, asking to make a phone call, he refused to let her in, later relaying the experience to a good friend. On November 18th, a supervisor at the treatment plant became increasingly worried when Keith, who had always been a reliable worker, didn’t show up for his shift. He had not informed anyone of his absence, and calls to the Dardeen home went unanswered all day. Keith’s supervisor even went so far as to call Keith’s parents, but neither of them knew what had happened to their son either. Concerned by the supervisor’s phone call, Keith’s parents contacted the sheriff’s office and agreed to drive to Ina with their house key to meet the deputies. What they found within the Dardeen’s mobile home was far worse than anyone had been ready for, and would scar them for years to come. Lying together in the mobile home’s bed were the badly beaten bodies of Elaine, little Peter, and the newborn baby. Elaine and Peter had been bound and gagged with duct tape, both beaten so severely that Elaine had gone into labour, and had given birth to a little baby girl. Their attacker(s) had shown no mercy, and had beaten the newborn to death as well. Both Elaine and Peter’s skulls had been fractured. They were beaten with a baseball bat that had been a birthday gift from Keith, to Peter, earlier that year. Keith, however, was nowhere to be found. Neither was the family’s car. Not a hint of his whereabouts were found in the early hours of the investigation, and police assumed that Keith had killed his family and ran. A team was quickly assigned to search for Keith, but as quickly as they had been assigned, so quickly the team disbanded again, when the following day Keith’s body was discovered by some hunters, located in a wheat field not far from the family’s home. He had been shot three times, in his head, in the right side of his face, and in the left cheek. His penis had also been cut off. The family’s car was located shortly after, outside of a police station, some 11 miles away from the family home. The insides splattered with blood, police concluded that Keith had been killed inside the car. While autopsies could not conclusively say the order in which the family had been killed, one thing was certain, they were all killed within the same 2 hour time span. Fear in the already on-edge area grew even stronger as news of the violent murders spread, security systems and guns both saw a rise in sales, and the once welcoming locals now made sure to check twice if their doors were locked. It is therefor no wonder that local law enforcement responded with force, and a total of 30 full-time investigators were put on the Dardeen case. Despite interviewing 100 people, yet not finding any leads, investigators were set on finding the motive behind the gruesome murders. One by one investigators eliminated possible motives: there had been no sign of forced entry, and not only a VCR and portable camera had been in plain sight, cash and jewellery had been up for grabs in just the next room. As far as the police could see, nothing had been taken from the home. Police turned to a possible sexual motive, due to Keith’s mutilation, but that too was dismissed. Neither had they found any evidence of an extramarital affair involving either of the couple, nor could they find anyone who had a grudge against them. They ruled out any debts, any problems, any disagreements the couple might have had, and slowly the well of possible motives started to dry up. Police did find a small bag of marijuana in the trailer, too small to indicate that either of the couple had been dealing, so that angle too was discarded. Eventually rumours of a satanic cult ritual started floating around the little town, because of how brutal the murders had been, but police had not found any kind of satanic symbols, and dismissed these rumours. Furthermore, police were convinced that the couple had been chosen deliberately, and that the murders had been very personal. Desperate not to let her son’s case go cold, Keith’s mother, Joeann, collected over 3000 signatures in an attempt to get the case featured on The Oprah Winfrey Show, but the producers turned her down, stating that the murders were too brutal for daytime television. America’s Most Wanted initially had a similar reaction, but in 1997 agreed to dedicate a segment to the Dardeen case, hoping to generate new leads on the horrific murders. This effort, however, turned out to be in vain, as no new leads were discovered following the airing. In 2000 there suddenly came new life into the case, when serial killer Tommy Lynn Sells had confessed to the Dardeen case, and many more, following his arrest for the murders of two young girls in Texas. While Sells could be conclusively linked to 22 murders, he could not be linked to the Dardeen family. Not only were several details of his statements wrong, like Elaine’s position on the bed, his supposed story of running into Keith in a pool hall and being invited back to their home for a three-way with Elaine did not at all fit the very protective Keith that everybody knew. The details that Sells did get right had all been public knowledge and were things he could have easily picked up watching the news. Sells was eventually put to death in 2014. Today, over 33 years later, the case is still unsolved, and any semblance of a motive is still missing. Keith’s mother has suggested several possible motives over the years, ranging from the idea that someone was forcing Keith to sell drugs, to Elaine having a possible stalker, or it being someone from her past, or perhaps even someone she rejected. Keith’s friend, the one who he had told about the young woman knocking on his door looking to make a phone call, wondered if perhaps that woman could somehow be involved. Police appear to either still be in the dark about a motive, or haven’t publicly shared it if they do have something, but either way, it seems unlikely that this case will be solved anytime soon. Some notes and thoughts: Clearly the marijuana was almost certainly for Keith’s personal use (since Elaine was pregnant.) Marijuana was looked upon very differently back then and Keith’s mother might have wanted to protect her son from judgement, which is why she might have come up with the “someone is forcing him” story. Considering Keith’s genital mutilation, I’m not sure how exactly police ruled out any sexual motives. I couldn’t find anything concrete on that, please point it out if I missed it somewhere. There are a lot of articles about this case, all with varying degrees of info. I do not believe Tommy Lynn Sells to be involved, I think he wanted to make himself look more prolific than he was, and perhaps try to avoid the death penalty by “cooperating” on closing several murder cases. But I did think that his “confession”was worth mentioning. Wikipedia Link Keith’s FindAGrave Elaine’s FindAGrave Edit to add some possible questions: How did the killer(s) get to the Dardeen home, if they were able to drive away with the family car? Did they walk there? Was there a second person driving the killers’ car? If this was premeditated, why did the killer(s) use a baseball bat already owned by the family? Wouldn’t it have made (more) sense if the killer had brought their own weapon? Does that make this a crime of opportunity?
Hold crypto for over 1 year = long-term capital gains = 0% tax under if $40,000
Just a public service announcement.
AMERICAN TAX LAWS If you hold your crypto for over a year and sell it after that time, its considered a LONG TERM INVESTMENT. You do not pay the same tax rates on it. It could be as low as 0% tax rate. https://www.nerdwallet.com/article/taxes/capital-gains-tax-rates
What is long-term capital gains tax?
Long-term capital gains tax is a tax on profits from the sale of an asset held for more than a year. The long-term capital gains tax rate is 0%, 15% or 20% depending on your taxable income and filing status. They are generally lower than short-term capital gains tax rates.
The tax rate on most net capital gain is no higher than 15% for most individuals. Some or all net capital gain may be taxed at 0% if your taxable income is less than $80,000. A capital gain rate of 15% applies if your taxable income is $80,000 or more but less than $441,450 for single; $496,600 for married filing jointly or qualifying widow(er); $469,050 for head of household, or $248,300 for married filing separately. However, a net capital gain tax rate of 20% applies to the extent that your taxable income exceeds the thresholds set for the 15% capital gain rate. Note: Net short-term capital gains are subject to taxation as ordinary income at graduated tax rates. https://www.cpajournal.com/2019/01/24/the-taxation-of-cryptocurrency/
IRS Treatment of Cryptocurrency
The IRS addressed the taxation of cryptocurrency transactions in Notice 2014-21, which provides that cryptocurrency is treated as property for federal tax purposes. Therefore, general tax principles that apply to property transactions must be applied to exchanges of cryptocurrencies as well. Notice 2014-21 holds that taxpayers must recognize gain or loss on the exchange of cryptocurrency for cash or for other property. Accordingly, gain or loss is recognized every time that cryptocurrency is sold or used to purchase goods or services. How the gain or loss is recognized depends largely on the type of transaction conducted and the length of time the position was held.
Settled for cash.
Cryptocurrency gains from trading coins held as capital assets are treated as investment income by the IRS, and the same capital gains rules apply. A taxpayer who sells a coin position for cash must report a capital gain on Form 8949. A coin position held for one year or less is considered a short-term capital gain, taxed at ordinary tax rates; a position held for more than one year is considered a long-term capital gain. I will just leave this here..... Tax his land, tax his wage, Tax his bed in which he lays. Tax his tractor, tax his mule, Teach him taxes is the rule. Tax his cow, tax his goat, Tax his pants, tax his coat. Tax his ties, tax his shirts, Tax his work, tax his dirt. Tax his chew, tax his smoke, Teach him taxes are no joke. Tax his car, tax his grass, Tax the roads he must pass. Tax his food, tax his drink, Tax him if he tries to think. Tax his sodas, tax his beers, If he cries, tax his tears. Tax his bills, tax his gas, Tax his notes, tax his cash. Tax him good and let him know That after taxes, he has no dough. If he hollers, tax him more, Tax him until he’s good and sore. Tax his coffin, tax his grave, Tax the sod in which he lays. Put these words upon his tomb, "Taxes drove me to my doom!" And when he’s gone, we won’t relax, We’ll still be after the inheritance tax.?
How I got a (not really an) HOA disbanded - and destroyed a bitchy "President of the HOA" in the process. Warning: LONG ASS READ! - So long in fact, I had to split it into two parts! This is part 5-8
I was invited by one of the mods to share this here as a mega thread, so here goes... Edit - apparently this saga was so long that I had to split it into two parts. This is part 5-8. Well, apparently I need to put this in here. I do not give consent for my posts to be read/interpreted/posted to any monetized or ad-supported platform. Examples include YouTube or other platforms. Short version: If you make money off reading someone else's posts, I do not give consent for you to make money off of my posts. Part 5: IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division. These are people with arrest power, by the way. And yeah, that's important later in the day. When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence. Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it. Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV. Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN. Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well. I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better. My friend came over and told me he had something to show me. He pulled out his phone, and gave me an absolute shit-eating grin. He made me wait for it. It was worth it. Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk. I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV. Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent". Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper. And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house. With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS). I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV. She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!" My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard. I couldn't help myself. I smiled, and waved. She flipped me off, turned on her heel, and stomped away. I've had a permanent grin the rest of the day. PART 6: Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally. As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.). As I mentioned in the comments in part 5, the Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points. So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence. Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof. Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face. I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with. Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name. Again, lots of conjecture, but nothing that could be entered into evidence in court. Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "stragetic lawsuit against public participation". You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights. So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something. I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system. I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced". This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week). During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece. She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace. "Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution. Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]." (This is not an exact quote, I may update it if I get a copy of the court transcripts.) As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best. We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away. At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon. At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time. That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt. Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away. They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit. My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to squeeze water from a stone get paid myself. Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows. My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her. Just for grins... Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit. Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home. So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth. So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate (yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES". Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank.. I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner. PART 7 (TAZERS!): So with the Coronavirus fun and excitement that everyone has been having, most of the courts in our area have slowed way down. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate. We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle). So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy coming stumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell? If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a pistol and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt. I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door. Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the ass. And it did give me a front row seat for the shenanigans that were about to follow. I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud. I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything. This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just kill myself right here right now and maybe you'd be happy with that too!". Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself). So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone. She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general. It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands. Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more. Two steps. Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her. She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point. The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the COVID issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date. So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence. Whoopsie. As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked. Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified. I do believe she has picked that shovel back up and dug her hole that much deeper. PART 7b: Well, someone messaged me asking for an update - I'll keep it brief: She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses. She made it abundantly clear that if it weren't for the current mess with COVID, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours. A quick look at google maps and we had our answer "75 feet, your honor". The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time. The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying. The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe - again once this COVID mess is over. I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through. Plus the possibilities of appeals, etc. Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :) PART 8 - THE END?: But first, the obligatory TL;DR: President of a fake HOA is a bitch to my wife. Gets sued, loses her husband, career, car, and house. She tries to sue me and loses. Decides to get drunk and belligerent, gets tazed. And now is convicted of multiple counts of fraud (misdemeanor and felony) plus a bunch more lawsuits filed. So a slightly longer summary is that when my wife and I bought our home, we were very specific in avoiding HOA's. After moving in, we met the "president of the HOA" behind our house. AT FIRST, she seemed nice enough, but little did we know the insanity that was going to come out of her. So we hired an arborist to take down a hazardous limb from a tree, and weren't able to move the wood onto our property the day of since he finished late and I was heading out of town the next day. The psychopath decided to freak out on my wife, until she browbeat her into moving these wood rounds (some weighing in excess of 100 lbs) by herself. They were stacked neatly, out of the way, and in no way an impediment to foot traffic. She claimed that the area that the rounds were stacked on was private property of the HOA (turns out it wasn't!) and that it needed to be moved immediately. Well, some time later, some hedges that were growing on the "HOA's private property" pushed over a section of our wooden fence. E-mailed her, and the short version of her reply was that it wasn't their property and wasn't their hedges so we were SOL on getting our fence fixed by them. Waitwhut? This kicked off a couple of weeks of calling a multitude of county departments to find out who actually owned that chunk of land. Eventually learn that it is actually county property as part of the right-of-way that was ceded to the county for a road. And the reason it took so long to figure this out was that there *was* no HOA registered with the county. So I sent an anonymous letter to everyone in the "HOA" with what I had found out. Cue everyone in the fake HOA suing her ass for fraud. Her husband, who was not in on the scam, promptly files for divorce - he wants absolutely no part in this. IRS and state revenue agency start crawling up her ass for back taxes. She was a real estate agent and principal broker. Those licenses were revoked by the state. She loses her job. House goes up for sale, it's listed for abut 15% higher than comps and it's still a short sale - so she's in deep trouble financially. She gets arrested for interfering with the duties of a federal agent when the IRS comes knockin - and they seize her brand new Mercedes SUV to boot. Tries to sue me, loses badly, and has to pay my costs and attorneys fees, and I file for a protective order because she's crazy. Gets drunk and belligerent, violates protective order. Gets tazed by the county mounties for her troubles. Jail again. Stronger restraining order. That all brings us to the beginning of this final update.... Due to COVID, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case. Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony. I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package. So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them. The prosecutor then had to get his last jab in, "So Mr. AmbulanceDriver2, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her? "What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood." I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies. I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart. There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated. Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on. And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify. I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far. But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims. Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits. I suspect that number has grown since then. I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.
Test drove my first Tesla today with every expectation of buying a new SR MY
Good morning, all. Last night I went to the closest Tesla dealership for a test drive and my first ever experience with a Tesla/EV. I spent hours and hours on research over the past several months and with the recent release of the SR MY and myself purchasing my first home, I thought I’d finally be making the switch. Please excuse the wall of text; I’ll work on formatting once I get coffee and sit at my PC. For now, I’m writing this up from my bed as the memories are fresh and I’m unable to sleep. A bit of background: I’m a 30 year old guy who would consider myself a former “car guy” but have shifted towards practicality in recent years. Loving tech and finally having my own home to charge an EV, I thought this switch would be a no brainer, but my test drive didn’t seal the deal for me as expected. I test drove the new SR MY as this is what I had decided would be the model I would buy. I wanted to make sure that I didn’t test drive a performance model and then purchase the SR, which I can imagine feel vastly different in terms of acceleration. First thing I noticed- The seats were the most comfortable that I had ever sat in. Truly, they’re a dream. The white interior was beautiful in person and the leather felt so smooth. Myself and my GF talked about them repeatedly on the ~45 minute drive home, but unfortunately, that’s where the wow factor stopped. Upon sitting down into the Y, a Tesla employee gave me a brief rundown of how everything works prior to our departure. Shockingly, the screen was unresponsive and laggy on more than one occasion and section of the settings. This was extremely surprising to myself, my GF and the employee and certainly disheartening, given the fact that everything is operated from this screen. It occurred again, even while on the drive and my GF attempted to click around. Is this common? I sure hadn’t seen it in the YouTube videos I had viewed. I’m not sure of an explanation but I can’t think of a great one. One foot driving- This didn’t come as a surprise to me like it may to some as I had read about it pretty extensively. But the harshness certainly took a bit to get used to. During my drive, I wasn’t able to master it and become a smooth driver. Sure, it would probably become second nature after a few days. But with my small taste of Tesla, I can’t say I loved this feature, but certainly understand the engineering benefits. The pano sunroof was beautiful! I loved it but also wondered how effective the tint is when the sun is overhead. I previously owned a 2016 VW GTI that had a mesh screen that covered the sunroof when closed. Even with the mesh and the tinted glass, I still found myself wanting a form of a blackout cover. I can’t help but think that the MY would also leave me feeling this way at one point or another. I’d love to hear back Fr on anyone with opinions on this. Space- This was my favorite aspect of the vehicle. Sitting upright, comfortable and having tons of cargo room was truly incredible. I also laid down in the back with my GF and I can confidently say that we could sleep in this vehicle if we were to take it camping (I’m 6’4”). Suspension- Many reported a harsh ride in their MY. I didn’t find this to be the case at all. The car rod smooth, lacked major wind noise (single pane glass on this test drive vehicle) and was overall very pleasant to ride in. Acceleration- Many people overhyped this for me. Although the SR MY is “slow” for a Tesla at 0-60 in 5.4 seconds, many told me that the instant torque of an EV would surprise me and be very addicting. This was not the case at all. Enough so that I asked the sales associate to come out to the vehicle after my drive to see if the car was on valet mode or something similar. It was truly sluggish and not in any way impressive to me. Context: I currently drive a 2019 VW Golf R with minor modifications that have my 0-60 at ~3.5 seconds. FSD- I had zero intentions of purchasing this package but knew I had to try it on my test drive. From lack of aggression to hugging the yellow line around turns, I wasn’t able to tolerate allowing the vehicle to drive for long. I didn’t feel initial confidence in it and in very little time, I confirmed the notion that I wouldn’t want to pay for that feature. One question I do have to you all- is the audible tone announcing a green light available without self driving? I truly loved that feature. Overall if I had to rate the SR MY, I’d probably give it a 7.6/10. It’s a fine car and may scratch the itch for those wanting a spacious EV for less than a MX, but for me, the hype was far too strong. I came in with high expectations, expecting to leave the lot, placing an order and saying goodbye to my beloved Golf R. But I can confidently say that I won’t be purchasing a SR MY anytime soon, if ever. I know I’m disparaging this vehicle in a Tesla subreddit where the fans are passionate, but I wanted to accept the downvotes that will follow in hopes of giving an unbiased opinion that differs from the majority that I’ve came across. I’ll gladly answer questions about my experience in the comments and would love to hear feedback from anyone who is willing to cultivate constructive conversation regarding this topic. For now, happy Sunday and thank you for reading. EDIT: I made this post with one intention- To educate those who are potentially interested in the new SR MY, more specifically, individuals with no experience in the EV world like myself. I was hoping to learn more, answer questions and cultivate good conversation on the topic and my specific situation. Prior to posting, driving the car and even before researching, a great friend of mine whom I respect a lot warned me that this sub was “a cult”. I didn’t dismiss his opinion but I also didn’t allow it to stop me from posting honestly. Unfortunately after reading the responses here, many of these replies are very emotionally charged. I have been downvoted for stating facts, such as “no, it was not in any form of valet/chill mode” confirmed by a Tesla employee. Downvoting factual responses devalues the voting system on Reddit and screams cult following with blinders due to a preconceived dedication to a company. This blind consumerism is something that I’d urge you all to think critically about and attempt to avoid in the future if you truly love this company as it seems. The detrimental effects of this mindset drive lackluster development and competition, allowing for companies to produce mediocre products and slows innovation. I truly do not see this happening with Tesla, as they’re extreme innovators and I admire the barriers they have broken. But this type of behavior can easily become the norm for many other facets of life, interests and purchases. All of that said, I’m considering scheduling another test drive. One with a dual motor MY to see how “peppy” it feels, and in hopes that the screen freezes were an anomaly. I’ll likely report back with an update upon completion of this test drive, but know, it will be another brutally honest review. I expect the continued downvotes but thankfully these made up internet points mean nothing. Happy Super Bowl Sunday, all. And please strive to remove emotion from your judgement when possible.
Melb heat wave Cooling tips, if you have an Evap Cooler you're stuffed.
I work in the Heating & Cooling industry mostly residential/domestic/commercial, started in the family business and last 6yrs on my own- less headache lol. I have seen the weather change(Climate change is real), forcing me to change my business and services to adapt to the weather and my clients comfort. One thing we have found is that Evaporative coolers are not keeping up, not worth buying or installing new in your home in my opinion. Literally a giant box with 1 fan inside, water pump & water trickling on the sides that's all! Many manufacturers wont tell you this, but you may find it in the fine print, the Evap cooler is only really designed to cool 10-15degrees less then Ambient Air temp. And if its humid your essentially stuffed unless you know how to tweak the controller settings and open/close doors/windows in your home, but that's not even 100%. So if its 40 outside, expect your Evap to blow 25-30 degrees air inside, this is not sufficient to cool a house or maintain a comfortable temp for multiple hot days. If you don't believe me, next time its hot place a temp reader under your Evap vent. Refrigeration Cooling is the way to go, either Wall Split System or Ducted. Only down side it can get a bit pricey on install cost and usage, but in my opinion it is will worth it.
P.S. this is not an ad or sales pitch for my business. Currently 3weeks booked out and we are struggling to get parts/units due to covid and everything being made overseas. edit: spelling & spacing to make it easier to read? edit 2: Just realised i never really gave tips, see the following for extremely hot days. EVAP COOLER. I recommend having someone come out every 2-3summers to actually wash it, make sure you check they use a hose & water, some companies offer "service" but dont do that. Turn it on from the morning early before it starts to get warm, keep the fan on low speed. You need and want the evap to be nice and wet all over so that when the day gets hotter whatever water evaporates does not slow the cooling down, as the day gets warmer increase fan speed. Do not expect to turn the evap on from midday or onwards when heat has already at its highest point and expect it to cool instantly, it will take 20-30mins if not more just to make all the pads/filters wet. Even more warm nights that will be followed by a hot day, need to remain on too keep it wet. Doors/Windows: Not every door or window needs to be open, you are only allowing the pressure out and you should be trying to achieve an internal draft using the evap cooler. One trick is to use a tissue next to the window/door and it should get stuck or blow out. Open/close to see how much the tissue moves, if its windy on one side of the house do not open any windows or doors especially if it is a north/hot wind. You may even realise the sound of the evap changes as you open doors and windows since you are reducing back pressure on the fan motor. If you lock yourself in a bedroom for some me time or whatever, make sure you crack that bedroom window open to relief pressure form that room vent. You can even adjust those small squares in the vent, just be careful they get brittle with age. On humid days you may need to open more or less windows/doors depending on your home, each home has as "sweet spot", if your controller or evap allows it, shut of pump/cool mode and run fan/vent mode. Just dont forget to switch it back on the next dry hot day. You should not have a wet floor, this means something is not right with airflow. Google search brand and model for manuals and etc.
WALL SPLIT SYSTEMS & DUCTED: All aircons of this type have a filter, which should be cleaned every 6-12months even more depending on use. Wall split systems have the filter under the front panel/cover which pops open by hand- google search brand/model to find instructions or read the manual. Ducted tend to have a big grill on the wall or ceiling that sucks air back, this needs to be opened the door will swing out and then the mesh/filter will need to be removed to clean. Cleaning the grill is not correct, filter is inside. You can both wash and vacuum your filters, in my opinion washing is better, especially if the filter is dark/sticky. Soak in hot water 5-10mins with dish soap. Be careful if you have the felt type, it may rip if its old. If you want to upgrade go to the Electrostatic style filter, its a fancy fly screen type of filter supposedly catches more dust. If you go outside to the CondensoOutdoor unit, do not place anything behind it between the wall and unit, or infront by 1meter. YOU WILL CHOKE THE SYSTEM. This is an actual Manufacturer requirement. Also keep surrounding garden/concrete clean, i have seen spiders/mice/lizards go in and damage the computers/inverter pcb on new system and repairs reach $1-$2k easily. Also dont be afraid to check external doors/windows if they are leaking in air, go to bunnings and splurge on door seal foam and etc. Helps keep the cold refrig air in and sealed. Use room fans in the house to keep airflow circulating especially if you have long corridors and are using a Wall split system. Also the fan does not have to push cold air away, you can do the opposite and face fans towards the aircon to help it suck the heat. If you call a company out make sure they test refrigerant gas, they need to use special gauges that connect and measure the gas, should also inspect coils, test electrical current amps/voltages.
GENERAL TIPS. House/Body Keep curtains closed to protect from sun, ive seen tenants use foil as an extra protection on some homes since they were struggling to get cooling from landlord. Blocking the sun makes a difference. Even on your own body, a few years ago i was realising i would crash when i got home after 40 work days, even though i drank a lot of water. Done some research and found my normal cap/hat is not sufficient i was still getting heat stroke since the back of my neck is exposed to the sun when outside. Now i got a Bunnings and kmart wide brim hat, they look good and under $10, also protect 360 around head. Sunscreen as well plays a big factor too. Keep vents/outlets open, look up at the ceiling do they seem half closed or not, you can even move/adjust some vents. Be careful the older they are the more brittle and can break. Use tissue or paper to test airflow, some vents will be slightly stronger or weaker then others this is expected with airflow distance travel. Drink lots of water, sometimes your body just needs to sweat it is a natural cooling method. Human body ideal comfortable room temp is between 21-23. I personally leave my Refrig on 23-25 during the day, and then 25-26 when i got to bed, with an auto timer to go off early hours of the morning if we expect a cool change.
I'm 25, make 16.24/hr in Edmonton, Alberta, and have written the world's most boring MD
Background: I am a 25 year old Starbucks barista. I was working full-time until fairly recently (Novemberish) as the rising cases in my city & my own health issues led to a really good talk with my boss. I have reduced my hours by 50% - enough to keep my health insurance, but enough to qualify for the Canada Recovery Benefit, an extra $900 every two weeks. This is for my own peace of mind as I really cannot afford to get COVID, especially as I am chronically ill. I’d like to make note of two things - I am one of those weirdos who has taken COVID seriously since it hit the news in January. My spouse and I had masks and sanitizer before it was cool, lol. As a result, I have not and do not go out much except to work. I do not see other people (the exception being this week as you will read.) I do pop into retail stores still as Canada Post is absolutely swamped with packages so I avoid trying to buy online. In this diary I am battling with a Crohn’s flare. I promise the exhaustion and joint aches are because of that, not because of COVID! Funnily enough, I do credit my Crohn’s for my ease with COVID-19 restrictions and lockdowns. Being that I was hospitalized for a long time as a teen, I find it easy to be isolated and stay isolated. I know a lot of people struggle with that. Onto the good stuff… The Positives Income: 16.24/hourly. I was promoted since my last diary and am now a certified trainer! CRB: $1800/monthly. I am so incredibly thankful that I have this failsafe. Student loans: I am back in school with more emergency management and communications classes. I applied for just enough of a student loan to pay the tuition and no more. Starbucks gives $1,000 of tuition reimbursement if you pass your classes which I can pay back onto my student loans and basically covers the cost of my classes this semester. The Negatives Rent/Utilities/Condo Fees: a flat $1050 monthly to S. The bills come out of his account and this is the number we landed on. Internet: $42.50 (my half - all bills are my half. S works for the city government in waste management and makes $63,000~ a year. He has no debts except his car loan & the mortgage.) Phone: $58.21 monthly for 13GB and unlimited texts and calls. I own my phone outright. NYT: $14.28 for the news, Cooking, and the crossword. Spotify: $4.99 monthly. Canadian baristas do not get the free Spotify perk. :( Headspace: $0 monthly. We do at least get this! Car insurance: $197.41 monthly. This is with a 9 year clean driving record, a reduced rate because of my grades, and the fact that identifying as a woman also lessens the price. And it’s still $2400 a year. Kill me. I own my car outright though. Google Photos: $2.79/monthly. Health insurance: $39/check to cover S and I, dental and medical. I am also on S’s so we have full coverage. Debts & Assets: Student loans: I have $8,000 in provincial loans and $11,000 in federal loans. They are on pause as I am in school but I was paying $215 a month towards them. I know I qualify for repayment assistance but the goddamn NSLSC will never pick up the phone. Car: It is a 13-year-old SUV and worth maybe $2,000. I will drive that thing until it dies. Savings: I have approximately $1500 in a TFSA. I have about $750 in Starbucks stock (not technically a savings, it was my grant this year + my own contributions, 1% from my paycheck.) I am also enrolled in their retirement plan. No idea how much is in that as I can only access the website on the work computer and never remember to do that. I have $150 in stocks because I thought I was going to be Jordan Belfort or something, idk. Tips: I hoard all of my tip money in a little jar hidden somewhere in my home. It is at about $475. I have no other debt. Day One - Tuesday 7:50: S kisses me goodbye and leaves for work. I snuggle back in. 8:10: M, my male cat, is tapping my face for breakfast. Ignored. 8:24: He tries again and I get up. Lately I have been noticing the time 8:24 a lot. I told S and he said he’s been noticing 10:42 a lot. So we have decided those are our angel numbers. M is no angel though despite waking me up at this time. 8:40: Everyone is fed and I make my coffee and let out the dog, K. Oh yeah… the dog… he was an accident. We did not intend on getting a dog. It is a long story. I love him to bits. 9:15: Finish my coffee and go upstairs to have a snuggle with Z, our female cat. She is so warm. I was intending on going out to buy M’s wet food today but it is snowing something fierce and I hate driving in the snow so I resign myself to staying indoors. I would also normally take K on a walk at this time but he had knee surgery this past year and the cold and snow really bother it, so we will do some indoor play and puzzles to keep him occupied (he is a corgi and is a monster without stimulation. Again, DID NOT INTEND ON THE DOG.) 10:00: Write these entries and tidy up our spare room. We turned it into a nap/cat/yoga den as we were, obviously, not having any visitors. However, my sister-in-law is pregnant and is coming down tonight for an advanced ultrasound as there is a tentative abnormality with the baby. Because her town has had 0 cases thus far - congratulations to them, honestly - and the outpatient clinic is the one two minutes from our neighbourhood, we decided it was OK for her to stay with us. She will drive down tonight and leave right after her appointment tomorrow. 12:30: Did some cleaning, cereal eating, bed-making, what have you. I go to take the garbage out to our complex dumpster in my tshirt and notice it’s not as bad as I thought despite the snow. So I gear up and take out K. 1:15: I’m so glad I did - he was so happy! Usually he starts limping within a few minutes if the cold is bothering him but he was putting his head and belly into the snow drifts so I know he was having a good time. The cold and the walk have wiped me out though. I eat a clementine and lay under my heated blanket for a nap with Z and K (M likes to watch the snow upstairs.) 4:15: K snores himself awake and barks at himself so I wake up too. Z looks annoyed and wanders upstairs. Three animals is quite the zoo. Check my phone and see my SIL asked if I could leave a dinner for her in the fridge, if I was making something? She left later than intended and won’t be here until 9 so dinner options will be limited. I tell her I haven’t been feeling well and S is at a union meeting tonight (why the union is doing in person meetings, I don’t know.) but it is pasta Tuesday at Boston Pizza… she readily agrees. I place an order for ravioli for myself and fettuccine for her. S will get fed at his meeting. My SIL says she will leave me cash for her half even though I try to tell her not to. Hopefully she forgets. (27.98 delivery, I’m going to leave a cash tip of $10 taped to the door for coming in the snow.) 6:30: I have enough of an appetite to eat my ravioli but only get through four pieces. I put it away to eat it later and feed the animals. I give K his puzzle bowl and he gives me a look of despair. 8:00: Ding! Crossword and mood log notifications go off. I get about halfway through the crossword when my SIL gets here. 10:30: We have a catch-up and exchange Christmas gifts as we couldn’t go up North for the holidays. Then I head to bed. I do my skincare and jade roll out a pinched nerve in my jaw - feels so good. Finish my crossword and then bed. Daily Total: $39.98 Day Two - Wednesday 8:24: Right on time, the tiny beasts request food. SIL is already gone. She left me a $20, argh! I put it in my tip jar as I took from there to leave the cash tip but I wish she hadn’t. Babies are let out and fed. 9:30: Manage a bowl of cereal. Feel exhausted. It’s -31C out so we play indoor fetch. Putter around the house. 10:30: Go upstairs and do my skincare and fill out my journal as I couldn’t last night. I bought a daily Moleskine planner but use it as more of a journal. I put on a Yoga by Adrienne video as I won’t be walking K. I work today so I stretch. 12:30: I lay down with K after some more fetch (I told you the exhaustion is real in this diary.) 2:00: My alarm goes off. I eat mashed potatoes and drink some water, then go upstairs to find M and Z cuddling in my vanity chair. I perch on the edge - because they refuse to move! - and do some makeup. I change into my personal uniform of all black (hides the stains) and set out. 5:00: I have my first break. I got $3 in tips from last week (lol) so I use it to buy a croissant. I’m gonna claim this as a +.82 because the croissant was only 2.18. 7:00: I only manage half of my pasta on my break, which is unusual for me. I drink a mint tea to settle my stomach. 9:15: It was so dead we managed to finish everything super quickly. I take home some expired oat bars as they’re the only Starbucks snack S can eat. 9:30: Home and greet everyone. S lets out K and goes upstairs to get ready for bed. I do my “closing tasks.” This is something I picked up from the TikTok account domesticblisters, who is a licensed therapist. She has this concept of care tasks, and what tasks you should do to help set yourself up for success every night - even if it’s just to survive the day. It really resonated with me and is something I have done every night since November with a few exceptions! I start my closing tasks after I finish my nightly crossword. Every night, I fill up all the waters in the house (ours, animals, the Keurig, etc.) I get to Sink Zero, which might mean loading the dishwasher and running it, or washing all the dishes in the sink. I disinfect the sink and scrub the stove, then disinfect the counters and the dining table. I do a Swiffer of the floor (K brings in lots of pawprints and salt from outside.) I pick up any garbage/recycling/things that don’t belong downstairs. It is so nice to come down every morning to a clean main floor and sets the mood for the day. And it only takes me 20ish minutes. 10:00: Done my tasks, give everyone a little treat for not walking on the wet floor - they’ve learned quickly that if they wait they get a treat - and head upstairs. Journal, do my skincare, floss, brush, and head to bed. Listen to Temple Rain on Headspace. Daily Total: +$20.82 Day Three - Thursday 8:00: I can already tell today is a bad stomach day. Luckily my boss texted me and asked if I wanted to give up my shift as it was going to be super dead with the impending snowstorm and deep freeze. I readily agree and doze off for a few minutes before M bites me hard enough to get me up. 9:00: Everyone is fed, let out. I drink coffee. K is being a major snugglebug. It is snowing like crazy out but I have to go do some errands. 12:00: I stop bumming around and gear up to go outside. It’s still snowing. Ugh, Alberta. First stop is to get gas. I have a quarter of a tank left. Remember in April when gas was like, 50c a litre? It’s 1.06 today. Also, fellow Canadians, the Esso Speedpass app is a godsend. Not having to touch any buttons on the pump has been so helpful. 45.93 Next I head to the grocery store to get milk, chicken, and cereal. I also end up getting soup, a new bubble bath, a replacement of my body wash, and a new leave-in conditioner. 27.66 (my half) Third stop is the pet store. I grab a flat of M’s wet food. At the checkout the cashier asks if I want to donate some canned food to the local rescue as they just picked up nearly 100 kittens. That suckers me and I say yes. I also note that they’re accepting old blankets/comforters, as we just switched our duvet out, and the old one is fluffy and perfect for furbabies. 32.29 (my half) Lastly, I go to Canadian Tire to pick up an online order I placed. It was paid for last week. It’s a gift wrap storage bin as we accumulated a bunch of rolls last year and the cats keep scratching it. Canadian Tire is fun because they have these lockers they place your order in now, and give you a pin to pick it up, so I don’t even interact with anyone. In and out. 2:00: Home and everything sanitized and put away. I wipe down my phone and watch and throw my gloves in the washer as they’re looking kind of grimy. Have a rest with K. 5:00: We play fetch and S comes home. K runs around like crazy. I go upstairs and work on a paper. 7:00: I have an appetite! I manage about 6 pieces of ravioli and some yogurt. S makes chicken wings for himself. 8:00: Go upstairs to finish off my paper and get my steps in. M is whining at me so we play with his favourite toy, a piece of twine. I do my crossword, drag the twine, and do my steps at the same time. It’s called multitasking. I make a lemon ginger tea. It’s disgusting but I drink it all as I’ve heard it has great benefits for your stomach. Does anyone else just not like tea? I’ve tried tons - thanks to Teavana at work - but I’m really only a real Indian cha girl. 9:30: I finish my steps, do my closing tasks, take a melatonin, do my skincare, and head to bed. Goodnight world. Daily Total: 105.88 Day Four - Friday 7:45: Everyone is being very loud and banging around this morning. 8:20: Feed the zoo, let out K. It is snowing again and it is a vicious -27C outside. I have my coffee. 9:30: Realize my paper is due today. It’s mostly finished so I don’t fret. Eat cereal and start a load of laundry, and then vacuum. 10:30: Get distracted looking up refurbished Apple Pencils. I don’t need one, I don’t need one… I click out of the page. Then reopen it. Then exit it again and watch TikToks instead. 11:00: I pluck my eyebrows - something I’ve done on my own for about 7 years now. I wonder how much money that’s saved me. I put on snail essence but don’t do a full skincare routine as I intend on a shower. I do a full hair treatment with a desi hair oil. I wrap it up in a bun and get to work on finishing my paper. 1:00: Finish and submit. I air fry pork buns for lunch. My stomach feels way better today. Maybe the tea made some points… 3:00: Finished my shower. My natural curl has come back in full force. I used to have tiny ringlets as a kid and they vanished with age. Then I saw a TikTok (again, lol) which essentially said: if you’re not white, why are you using white hair products? I switched to desi & black hair products a month ago and the difference has been crazy. 5:30: S is home and K is immediately crazy. I really miss our walks. I decide to corral him momentarily in the bathroom and hide his kibble around the main floor so he can do his sniffari for dinner. He loved this game! 7:00: I try to build a Notion dashboard. This is too hard. I eat some more ravioli. Sorry for my five-year-old diet in this. It’s a bowel rest diet. 8:00: Crossword, steps, and M play time. 9:30: Closing tasks! Then bed. Daily total: $0 Day Five - Saturday 7:45: Woken up by the usual ruckus. 8:30: Blah, blah, blah. Have my coffee. Make an egg sandwich because Saturdays are chaos and I need the protein. 9:30: Do my skincare, makeup, and hair while a nervous pit opens up in my stomach. Not only is it a cool -35C out, but Saturdays are terrible at work. I’m not a crier and have never cried at any place of employment until Saturdays @ the Siren. It’s gotten worse during the pandemic as people crave normalcy and to them, getting their coffee every Saturday is normal. But they refuse to treat us with any decency. It’s hard when you are treated as expendable so that white-collar WFH/SFH families can berate you over how long their $40 order takes. (I work in a very wealthy area.) Also, if I am put in the drive-thru window, I will be very grumpy about it. 1:00: I was put on bar, which is a lot of responsibility on a Saturday. I buy a butter croissant and drink a mint tea on my break. 2.38 3:00: Someone yells at me about the bathrooms being closed. 3:30: I eat the last of my pasta at lunch and have a blacktea lemonade. 5:00: Someone returns a drink twice for not being the right shade of pink. She tries a third time and I politely tell her another store can make the moment right, since we clearly can’t. I hate Saturdays. 5:30: Free and covered in syrup, milk, and a mango dragonfruit that exploded at my feet. I take a hot shower and decide my day is done, so I do my skincare and remove my makeup and contacts. 8:00: S finishes gaming with his brother and I make a stir-fry sans veggies for dinner. 9:30: Closing tasks, except no mopping because the ground is frozen so K hasn’t brought in any tracks. I floss, jade roll, and fall asleep. Daily Total: 2.38 Day Six - Sunday 8:24: M pats me awake. 9:00: I apologize for this being the most boring Money Diary of all time. Coffee and toast for breakfast. 12:00: Bummed around all morning but did a vacuum and started a load of laundry. Tomorrow is our weekly “reset” day so I don’t have much to do today. I work at 5 PM. I research photobooks on Shutterfly. I have 30,000 photos sitting in my Google Drive and a backup hard drive. It’s serving me no use so I want to go through them, make photobooks, and delete the rest off of my computer (keeping them in their backups.) They’re currently 50% off but it would take me a long time to do seven years’ worth of books so I can’t (and won’t) pull the trigger now, but I also know Shutterfly and vistaprint host many sales, so I’m not too fussed. 2:00: We have a Zoom call with S’s family to do a late Christmas opening together. The kids (and adults!) love their gifts. We talk about the cold and about the new niece or nephew on the way. 4:30: I go upstairs and get dressed for work. S is driving me so I don’t have to worry about starting my car in the cold. It is supposed to reach -41C. 5:30: I forgot it was Superbowl Sunday. Our store is located next to the turnoff into the plaza so we try and count how many Ubers are coming in for food pickups but get bored of that. Somehow I get water on the ceiling. 7:00: I eat an “expired” croissant and drink a mint tea on my break. A woman comes through drive-thru for just a cookie. She says she didn’t know there was a Starbucks here so she had to settle for another coffee chain’s iced coffee, and then drove by and saw us. I tell her to wait and come back with a free iced coffee because no one should be subjected to the other chain’s. To my surprise she bursts into tears. A very wholesome interaction. 8:30: It’s so dead my supervisor lets the other closer go home because we’re basically done for the night and he lives 40 minutes from the store. 9:30: I leave with my coffee bean markout and another “expired” croissant, as well as a blacktea lemonade for S. We wait to make sure my supervisor’s car starts as she drives a ten-year-old minivan that recently got rear-ended, and it didn’t start last night apparently, so she had to wait for her husband to come boost her as everyone had left. She flashes her lights at us and we leave. S wants McDonald’s but I don’t so he orders and pays for just himself. 10:30: Done closing tasks. I had some soup for dinner. Bed time. Daily Total: $0 Day Seven - Monday 8:00: I did not sleep well. M bites me and I grumble at him and hide under the covers. S gets up and feeds the animals instead. 8:45: Everyone is waiting for me to come downstairs. Being a pet mom is like being a celebrity. 9:30: Coffee and my croissant from last night for breakfast. 10:30: It’s reset day. Every Monday I clean out the fridge, dust/clean the appliances and cupboards, wash the sheets, do a major vacuum (we do small vacuums during the week but I have a Bissell Crosswave and use it every week to suck up the oodles of pet hair.) and refill canisters. I also do some self care tasks like a serious eyebrow groom, a hair oil, an Aztec face mask, clipping all my nails/painting my toenails, and in the shower I shave my legs for the week. The animals also get a spa day. We check toenails and brush them out. Then the week is nicely set up and we don’t have to worry about this stuff until next Monday! S is braving the weather to go to the grocery store. He comes back with a full haul as there was quite a bit of discounted meat. We put it in the freezer. 48.33 (my half) 2:30: I finish the main floor items and go upstairs to find S and the cats in the nap den bed. I decide to crawl in too and we have a major cuddle nap. K isn’t allowed upstairs so the cats have a space away from him, but we spend a lot of time downstairs with him, so I don’t feel too bad. 4:30: Up from the nap and do the upstairs chores, and then a shower. I break halfway to have some soup. 7:00: House is clean, I am clean, and animals are clean! S and I make Cajun rice for dinner. I do my steps and crossword puzzle. 9:30: Closing tasks, lights out! Daily Total: 48.33
Updated Walmart Jargon, acronyms, initialisms, and information you should know
4 years ago, u/melantonpsn created a jargon list for use by this subreddit. Due to recent updates and changes in the company, I decided to update said list. If you're still out there, melantonpsn, thank you for your hard work in creating the original list This is mainly just a copy/paste of their original list, with the new changes added in along with things I've learned from personal experience. It may not be 100% correct, but that is where you come in! If you see anything on here that appears to be wrong, or don't see something that you feel should be, please let me know so I can update the list. This is meant to help everyone, especially new associates, so it is imperative that we have the correct information. ​ Without further ado, I present to you the list: Types of Stores: SC: A supercenter Div 1: a smaller type of store. It carries less items and does not have all departments NHM: Neighborhood Market Sam's Club: A Walmart company that requires a membership to shop at Departments Apparel: 24: Boys wear 30: Bras and Shapewear 41: College and Pro Sports Apparel 33: Girls Wear 28: Hosiery 26: Infant Apparel 32: Jewelry and Sunglasses 31: Ladies Accessories and Handbags 29: Ladies Sleepwear 23: Men’s Wear 34: Misses and Junior Apparel 36: Outerwear and Swimwear 35: Plus size and Maternity 25: Shoes 27: Socks Consumables: 46: Beauty/Cosmetics 2: HBA 13: Household Chemicals and Cleaning Supplies 4: Household Paper Goods 79: Infants Consumables 40: OTC pharmacy 8: Pets and Supplies Entertainment: 85: 1 Hour Photo 21: Books and Magazines 6: Cameras and Supplies/Photo 72: Electronics 5: Media and Gaming 87: Wireless Devices 58: Wireless Services Food: 98: Bakery 1: Candy and Tobacco 81: Commercial Bread 90: Dairy 95: DSD Grocery 91: Frozen Foods 92: Grocery 82: Impulse/Checkout Merchandise 96: Liquor 93: Meat and Seafood 97: Meat and Deli Wall 94: Produce 80: Service Deli Homelines: 20: Bath and Shower 22: Bedding 14: Cook and Dine and Small Appliances 19: Crafts 44: Fabric 71: Furniture 17: Home Decór 74: Storage and Organization Hardlines: 37: ACC 10: Automotive 67: Celebrations 48: Firearms 11: Hardware 77: Large Appliances 56: Live Plants and Garden Supplies 16: Outdoor Living 12: Paint and Accessories 18: Seasonal (Easter, Halloween, Christmas, Thanksgiving/Fall, Valentines Day, etc.) 9: Sporting Goods 3: Stationary 7: Toys Miscellaneous: 50: Doctor Fees/Optical Service Income 65: Fuel 15: Health and Wellness Clinics 49: Optical 38: Pharmacy Prescriptions 89: Travel 86: Walmart Financial Services 69: Walmart.com sales 99: Store Assets Store Positions SM: the store manager. This is the highest role in stores. They are the ones in charge of the entire place. SL: Store Lead. This position exists only in certain stores. They work directly opposite the store manager, helping to run the day to day operations of the store. Coach: A salaried member of management who runs a wide area. The amount of coaches you have in your store will be determined by your store, as will what they are over. They report directly to the store manager. Coach Trainee: An hourly member of management who is in training to become a Coach. ASM: Assistant Store Manager. A salaried member of management who runs a specific area, much like a coach. Most of these positions were phased out with the introduction of the Coach role, but a few still remain. They report to the store leads or, in the absence of store leads, the store manager. APASM: A salaried member of management in charge of all things AP. This is mainly things like theft, but can also include other things as well. TL: Team Lead. Directly under the coach, these hourly supervisors run a small team. They work to develop the members of that team. They may also act as the manager on duty in the absence of a salaried member of management (must have training to do so). AT: Academy trainers. This position currently only exists in NHMs. This position is in charge of training new employees. In Supercenters, this role falls to the team lead. TA: Team associate. This is the regular associates of Walmart. DM: Department Manager. This position has been almost completely phased out, save for a few exceptions. Their job is to run a specific department. Claims Supervisor: The person in charge of claims. APA: Asset Protection Associate. This person is meant to help stop theft. They will often roam the store, keeping an eye on customers whom they deem suspicious and will deal with theft issues as they arise. SC(O)H: Self checkout host. This person watches over the self checkouts, helping customers and looks for items not scanned. APCH: AP Customer Host. This person is in charge of doing receipt checks at the doors. Stockman: a cart pusher Mod Associate: an Associate who sets mods. Often based on overnights. People Lead: often referred to as HR, they are the ones in charge of orientations, hiring, etc. Old Positions Cap 1: in charge of cleaning up freight and capping grocery and consumable bins. Replaced by stocking team 1 Cap Supervisor: In charge of Cap 1. Replaced by Stocking Lead 1 FCAP 1: Fresh cap team 1. In charge of working the Meat, Produce, Bakery, and Deli Freight and capping. Replaced by Meat/Produce team, bakery team, and deli team. FCAP 1 Supervisor: In charge of FCAP 1. Replaced by Meat/Produce Lead, Bakery Lead, and Deli Lead Cap 2: In charge of unloading the GM truck and working freight in grocery and consumables. Replaced by Stocking Team 2 Cap 2 Supervisor: In charge of Cap 2. Replaced by Stocking Lead 2. Support Manager: A position in charge of various things across the stores. Often referred to as "Managements bitch", they basically do whatever salaried members of management ask of them while often helping to run the store. Often viewed as a stepping stone between hourly management and salaried management. FCAP 2: Fresh Cap 2. In charge of capping, culling, and doing markdowns for Meat, Produce, Bakery, and Deli. Replaced by Meat/Produce team, Bakery Team, and Deli Team. ON: Overnights. In charge of different things which vary by store, but usually FDD freight, finishing up Grocery and consumable freight, and working GM Freight. Replaced by Stocking Team 3 ON Support Manager: In charge of overnights. They report directly to the overnight asm. Were also MODs in the lack of a salaried member of management. Replaced by Stocking Lead 3. CSM: customer service manager. Often found to be wearing yellow vests, they are in charge of running the front end. Replaced by Front End Lead Locations Grocery Doors: The entrance doors at the front of the store on the grocery side. Will stay open for as long as the store is open. GM Doors: The entrance doors at the front of the store on the GM side. Will often close earlier in the evening, funneling everyone through the grocery doors. Cart bay: where carts are stores for customers when they come into the store Cart rails: the set of shelves as you come into the store. Called cart rails as they’re right next to or near the cart bays Bullpen: the encircled area where the self check outs are located TLE: Tire and Lube Express. Also known as ACC (auto care center) HBA: Health and Beauty Aids. Also known as HBC (Health and Beauty Care) OTC: Over the Counter. Refers to Pharmacy L&G: Lawn and Garden FDD: Frozen, Dairy, and Deli CO: Cash Office Front End: The front of the store. The front end is usually located between the two entrances. It includes all the registers at the front of the store and the service desk, but also includes positions like maintenance and stockmen. Sales Floor: The area customers have available to shop Back Room: The employee-only area. This is where trucks are unloaded and overstock goes. HR, Management Offices (except AP), and the break room are also located back here. Softlines: Apparel departments Consumables: Items that people use often. These include HBA, Cosmetics, Chemicals, Paper goods, Infants, OTC, and Pets. Entertainment: everything often referred to as "electronics". Grocery: any food or drink item, not including fresh Fresh: Meat, Produce, Deli, and Bakery. Homelines: Things you would use in a home. Things like bedding, furniture, cooking items, etc. are located in this area. Hardlines: Basically everything else that doesn't fit into the above categories. These are things people may want, but aren't a necessity. Action Alley Action Alley: these are the areas in between departments. They are where customers and associates alike will walk as they are often the quickest ways around the store. They also will have features inside of them to increase sales. B Action Alley: The Action Alley that separates grocery from apparel The Cross: the section that separates apparel departments. As apparel is often a different color from the rest of the floor, it is easy to see the division here. Horse Shoe: Toys, ACC, Hardware, HBA and OTC. When looking at them from a birds eye view, they will often make a horseshoe shape, but this is not in all stores. Bowling Alley: the area between apparel and the front end registers. It is said that customers often look like bowling pins when they are lined up. May also be called the trench. Main Alley: The back most action alley. May also be known as Long Action Alley or Back Action Alley Race Track: All of the action alleys combined Walls Wet Wall: Located in Produce, its the wall with the fresh vegetables on it. Will often have rugs underneath to absorb excess moisture as there are sprinklers on this wall. Meat Wall: The area where meat is sold 97 Wall: the area that holds bacon, hot dogs, lunch meat, lunchables, and the like End Cap: At the end of all aisles that aren't against a wall. Features are set here to capture customer's eyes and sell more product. Zoning While zoning, Walmart employs a method known as fast zoning. To do a proper fast zone, take the following steps:
for the first layer (the layer touching the shelf) start at the edge of the shelf closest to you.
Fill all the way back until you reach the end of the shelf. Do not stack anything until this first layer is completed.
After the first layer is completed, you may start the second layer. The second layer (and all layers above this) start at the back of the shelf and come forward. Do not start another layer until the previous layer is full.
Stocking Case: a box of freight that holds multiple items inside of it that go on the shelf. PDQ: Product Display Quantity. Some products will come in special cases meant to show off the product better. Also known as SRPs (Shelf Ready Packaging) Breakpacks: the mixed boxes that come off the truck that will have small items in them that couldn't be thrown into the truck. May also be referred to as Totes, One Touch, or Casepack. Fast track: The piece of plastic that holds the shelf labels Bunkers: Located in grocery, these are the frozen or chilled areas not connected to the walls. They are often used for features. Also known as cooler bunker Stackbase: a 4x4 plastic/wooden pallet that goes in action alley. Holds features. COMAC: Food features that Home Office mandates TIP: Towel in Pocket. Some associates will carry towels with them so they can easily clean up small spills. Not to be confused with TIPS Buttholes: Hanging products can often rip, making it so they can't be hung anymore. Buttholes are sticky pieces of plastic that are attached to products like that so they can be rehung. May also be known as tabs, do-its, dang-it’s or damn-it’s. Topstock: The highest shelves. They are meant to hold products that can't go on the shelves. May also be called risers WACOs: Walmart Approved Corrugated Container. boxes kept on topstock or the backroom that are meant to hold products that don't easily fit on topstock or in the bins. Usually because they're so small or tend to roll around Transportation L Cart: an cart that makes an L shape with its handle. Also called a long cart Rocket Cart: a 2-leveled cart that folded up for easy storage. These carts are being taken out of stores due to a number of incidents where associates received injuries due to the latches failing. Top-Stock Cart: A cart with 3 levels on it. Attached to the front is a ladder, making reaching topstock much easier. May also be called a ladder cart. Pallet Jack: a 2 pronged fork on wheels used to drive pallets around the store. Electric Pallet Jack: an electric version of the pallet jack usually used to unload trucks or move especially heavy pallets. Walkie Stacker: a type of lift used to reach the top steel or stack pallets. Forklift: a type of lift used outside that is meant to carry and stack pallets. Can also be used to unload trucks. Scissor Lift: a lift that carries a person and possibly some merchandise. Mainly used in Lawn and Garden and during seasonal sets to put up seasonal decorations or signs. Trucks and the Backroom HVDC: High Velocity Distribution Center. This is the grocery truck. Also called remix McLanes: The candy truck. While it may have other departments in it (mainly pets, OTC, Tobacco, and grocery) it is almost all candy. Depending on location it may also be CoreMark Origin: The truck that McLanes arrives on Dance Floor: The space used for truck unloading Hole in the Wall: the Trash Compactor. May also be called Oscar (like Oscar the grouch) Baler: where plastic and cardboard are recycled. The baler makes compact, rectangular bales that are then taken to recycling centers to be reused. Bin: The individual areas where overstock is kept in the backroom. Steel: the steel that overstock is kept in. Contains the bins Top-Steel: where pallets of merchandise or other important items are stores in the backroom. Located at the top of the steel. Cap: The process of scanning items into a bin Pick: When capping, the scanner will tell you if an item needs to go out to the floor. Work: After capping, working the cart is when you take the cart of merchandise out and stock the items that were picked. Inventory Flow Process: the process of items making their way from the manufacturer to customers homes. CAP: Customer Availability Program. The process of making sure our shelves are stocked for the customers DSD: Direct to Store Delivery. Products that come in from warehouses other than those owned by Walmart. Are usually stocked by the vendors or reps from those companies. MABD: Must Arrive By Date OSCA: On Shelf Customer Availability. The percentage of items we have in stock and on the shelves so that customers may purchase them RPCs: Reusable Plastic Containers. the foldable plastic crates used in fresh departments. Backload: sending pallets, rpcs, and break pack boxes back to the warehouses so they can be reused. Miscellaneous CBLs: Computer Based Learning. Replaced by the ULearn System Telxon: an old scanner. Most stores do not have these anymore, but some still hold on to these relics. They are most often used in fabrics and crafts. Other forms of scanners include MCs or TCs. May also be referred to as a scanner, handheld, or gun (there are little triggers that sort of make the scanners look like guns Onboarding: The initial training videos associates watch when they are hired. Replaced pathways ULearn: The additional training associates will undergo every so often. TIPS: Threaten Intimidate Promise Spy. An illegal method of dealing with unionizing FOE: Facts, Opinions, and experiences. A lawful way of dealing with unionizing. The Mule: the machines that stockmen use to push carts Shopping Cart Party: When a group of associates goes outside to round up carts. Happens when stockmen fall behind. Also known as a buggy run HEATKTE: High Expectations are the Key to Everything (Pronounced Het-Ka-Tee) EDLC: Every day low cost. The way Walmart keeps prices low by reducing everyday costs. EDLP: Every day low price. Correlates with EDLC WOSH: Worked over Scheduled Hours. Will depend on the time of year and your management team, but as a general rule, working longer than you're scheduled is frowned upon unless you have management approval. You may be asked to cut any extra hours you accumulate throughout the week by taking a longer lunch or leaving early/coming in late OBW: One best way. This is the official way everything is supposed to be run. Most stores do not follow this, however, and run things however they please. Coaching: a disciplinary action. Open Door: the process of taking concerns, ideas, or problems to higher ups. Starting with your immediate supervisor (or the next step higher if your supervisor is part of the problem), you discuss the idea or problem with management until it is resolved. Ethics: a place to take all your ethical concerns. Be aware that ethics only deals with issues that are legal issues or are in direct violation of Walmarts Statement of Ethics. GWP: Great Workplace. The phasing out of old supervisor roles to make way for the new team system. Has been renamed Teaming. GAIN: global associate interactive network. the process of ending an associates employment. One Walmart: Walmart’s site for employees. May also be called the wire Me@walmart: a free app on the App Store that allows you to view your schedule. Replaced the mywalmartschedule app BYOD: allows you to download work apps to your personal phone. Only available in certain states. WIN: Walmart Identification Number. This is your employee number.
Explore wildlife bedding collections and camouflage bedding sets with dream-inspiring images of the great outdoors. Search sale prices and the latest selection at cabelas.com. Up to 95% Off Bedding Accessories. Shop at Swap.com for unbeatable low prices, hassle-free returns & guaranteed delivery on pre-owned items. Choose crib bedding sets in a celestial theme. Cheap baby bedding sets under 50 dollars are available on eBay. Choose from sets with moons, stars, clouds, planets, sheep, or teddy bears in colors such as blue, pink, and gray. Sail away with nautical-inspired crib sets for sale on eBay from brands like Nojo, Nautica, Just Born, and Rachel Ashwell. These used bedding for sale are found in both disposable forms for hospitals and non-disposable forms. These European and American styled used bedding for sale comprises sheets, pillow sets, duvet cover sets, cushions, and blankets with higher thread counts. Bedding. Beautify Your Bedding with eBay. With fall weather and shorter days just around the corner, consider giving your bedding a makeover. Sellers on eBay offer a large inventory of options, from full sets to individual pieces such as pillows and blankets. Shop bedding at Chairish, the design lover's marketplace for the best vintage and used furniture, decor and art. Make an offer today! Dining Sets & Chairs. Kitchen & Dining. Well, you can double that by adding brand new sheets into the mix with our bedding sale clearance. The perfect sleep sanctuary without the luxury price tag is ready and waiting to add some extra style points to your bedroom. So, why not explore our bedspread and quilt sale and treat yourself to some Find fashionable, affordable comforters and bedding sets to refresh your bedroom look. Get a fresh look and feel with high thread-count sheets in bright colors and styles. Find the perfect pillow for your best nights’ sleep in your bed. Browse our selection of bedding sets to find the perfect set to match your style. To complete your bedding, don’t forget your pillow shams, decorative throw pillows, blankets, and bedding accessories. Blankets and throws are used to add color, texture, and coziness to your bedroom when tossed across the bed. They also add functionality for a chilly night, or when lounging. Amazon.com: hotel bedding for sale - Used. Bedsure Bedding Comforter Sets Queen Comforter Bed in A Bag 8 Pieces - Grey Bedding Sets Queen with Comforter - 1 Comforter, 2 Pillow Shams, 1 Flat Sheet, 1 Fitted Sheet, 1 Bed Skirt, 2 Pillowcases. 4.5 out of 5 stars 4,894.
Used sofa set used dining table used bed used sofa cum bed ...
I hope enjoy videos plz like and share my videos subscribe my channel friends #moinsports #offertime my Vlog channel...https://www.youtube.com/watch?v=qXi8YN... Hey everyone, thought I would do a more detailed video about picking up and selling used bedding on eBay and the types of returns you can get on them :) I hope enjoy videos plz like and share my videos subscribe my channel friends#offertime#offerTimeelectronicstravel food....https://www.youtube.com/channel/UC... I hope enjoy videos plz like and share my videos subscribe my channel friends#offertime#offerTimeelectronicstravel food....https://www.youtube.com/channel/UC... I hope enjoy videos plz like and share my videos subscribe my channel friends#offertime#offerTimeelectronicstravel food....https://www.youtube.com/channel/UC... I hope enjoy videos plz like and share my videos subscribe my channel friends#moinsports #offertime my Vlog channel...https://www.youtube.com/watch?v=qXi8YNw...